I. Single nucleotide polymorphism (SNP)(b)(a)AlleleGenotypeNotationGenomeSingle-StrandNotationTTAGCTCTGATACHomozygousTAGCTCTGATACTCGAGACTATGTCHeterozygous TAGCTCCGATAC2AGCTCCGATACCCHomozygousCTCGAGGCTATGSingle base-pair substitution.1per1000 bpin thehuman genome.2001-over5millionhumanSNPsidentifiedMutation rate of1xlo-9per locus pergenerationArise by mutagenic chemicals or mistakes in DNA replication11-11
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-11 I. Single nucleotide polymorphism (SNP) I. Single nucleotide polymorphism (SNP) Single base-pair substitution. 1 per 1000 bp in the human genome. 2001 – over 5 million human SNPs identified. Mutation rate of 110-9 per locus per generation. Arise by mutagenic chemicals or mistakes in DNA replication
The origin of human SNP is determined by comparison toother species.The vast majority of SNPs occurs at anonymous loci(c)TTGACGTATAAATGATCTTTATATTTTCAGAAGTCHuman1Human2TTGACGTATAAATGATCTTTATATCTTCAGAAGTCChimpTTGACATATAAATGATCTTTATATCTTCAGAAGTC(d)116.750K116.800K116.850K116.900K116.950K117.050KWatsorVenterSNPsCEUGeneCFTRINMWNT2/NM_003391.TranscriptCFTRINPWNT2/NPCodingFig 10.611-12
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-12 The origin of human SNP is determined by comparison to other species. The vast majority of SNPs occurs at anonymous loci. Fig 10.6
SNPs can be genotyped with several methods1.Southern blot or PCR analysis of restriction site-alteringSNPS2.Allele-specific oligonucleotide(ASO)hybridization3.DNAmicroarrays11-13
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-13 SNPs can be genotyped with several methods 1. Southern blot or PCR analysis of restriction site-altering SNPs 2. Allele-specific oligonucleotide (ASO) hybridization 3. DNA microarrays
(a)EcoRIrestriction fragmentdetectedbyprobeSNPallele1Homolog11. Detection of SNPs thatProbeGAATTCGAATTCGAATTCCTTAAGCTTAAGCTTAAGalter restriction sites byEcoRIrestrictionsitesSouthern blot analysisHomolog2三GAATTCGAGTTCGAATTCCTCAAGCTTAAGCTTAAGProbeSNPallele2EcoRIrestrictionfragmentdetectedbyprobe02345kb1Restriction fragment length(b)Sizemarkerspolymorphism (RFLP)Genomicsamplesis one type of SNP that changes-DNA fragment size cut byspecific restriction enzymes.5kb3kbHomozygousforallele1Homozygousforallele2Fig.11.4Heterozygouswithalleles1and2
Fig. 11.4 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-14 1. Detection of 1. Detection of SNPs that alter restriction sites by alter restriction sites by Southern blot analysis Southern blot analysis Restriction fragment length Restriction fragment length polymorphism (RFLP) polymorphism (RFLP) is one type of SNP that changes is one type of SNP that changes DNA fragment size cut by DNA fragment size cut by specific restriction enzymes. specific restriction enzymes
(a)Normalallele(A)Detection of SNPs thatProGluGlu(translatedsequenceLeftprimerCCTGAGGAGalter restriction sites byGGACTCCTCRightprimerPCR analysisMstll restrictionsite...0100200300400500bpMust have sequence oneither side ofProValGluLeftprimerCCTGTGGAGpolymorphismGGACACCTCRightprimerAmplification of fragmentSickle-cellallele(S)Norestriction site(b)Restriction enzyme digestionASGelelectrophoresise.g., sickle-cell anemiaSgenotyping with a PCR-based protocol500bp(Sallele)300bp(Aallele)200bpFig.11.5
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-15 Detection of Detection of SNPs that alter restriction sites by alter restriction sites by PCR analysis PCR analysis Must have sequence on Must have sequence on either side of either side of polymorphism polymorphism Amplification of fragment Amplification of fragment Restriction enzyme digestion Restriction enzyme digestion Gel electrophoresis Gel electrophoresis e.g., sickle e.g., sickle-cell anemia cell anemia genotyping with a PCR genotyping with a PCRbased protocol based protocol Fig. 11.5