2. SNP detection byASO (allele-specific oligonucleotide)hybridization(a)1.21-baseprobe/targethybridwithnomismatchesProbeASOs are shortRaisetemperature1oligonucleotidesCompletelycomplementarytargetstrandof30-40 bases2.21-baseprobe/targethybridwithmiddlemismatchthat hybridize toRaiseonly one of thetemperatureAH新业E电电#联州业国电#电电服联电E电电two alleles at aMismatchatbase11SNP locus under(b)1.50-baseprobe/targethybridwithnomismatchesappropriateRaiseProbeconditions.temperatureTargetstrand2.100-baseprobe/targethybridwithonemismatchRaiseMismatchtemperatureFig. 10.1611-16
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-16 2. SNP detection by ASO (allele 2. SNP detection by ASO (allele-specific specific oligonucleotide oligonucleotide) hybridization hybridization Fig. 10.16 ASOs are short oligonucleotides of 30-40 bases that hybridize to only one of the two alleles at a SNP locus under appropriate conditions
(a)GACTCCTCSGAGAAGTOCGACTCCTGAGGAGAAGTGCThePCR/ASOASOforallele1ASOforallele2hybridization(b)1.Homozygote2.Heterozygote3.Homozygoteformethodforallele1withbothallele2alleles3U2PLin2-ASOscanPCRamplificationofall samples(c)determinegenotype at anyDenature.ApplyaSNPlocusdotofeachsampleontonitrocellulosefilters.3..3SHvbridizewithlabeledHybridizewithlabeled11-17
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-17 ASOs can determine determine genotype at any genotype at any SNP locus SNP locus The PCR/ASO The PCR/ASO hybridization hybridization method
HvbridizewithlabeledHvbridizewithlabeledASOforallele2ASOforallele1(a)-10000(e)Washoffunhybridizedprobeand exposetofilmAllele1Allele21.Homozygous2.Heterozygous3.Homozygousforallele1foralleles1and2forallele211-18
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-18 Hybridize with labeled ASO for allele 1 Hybridize with labeled ASO for allele 2
3.Rapid SNPdetection withDNA microarrays5500bpBRCA1codingregionrequires22000ASOs.Each column contains an ASOdiffering only at the nucleotideposition under analysis.BRCA1DNA from anyallele canhybridize with one of thefourASOs in a column0VITOnormalgenotypeTGCACAGTATTTCATTGGTACCTGG24202440IndividualwithheterozygousmutationTGCACAGTATTTCATTGGTACCTGG2420244011-19
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-19 3. Rapid SNP detection with DNA 3. Rapid SNP detection with DNA microarrays microarrays 5500 bp BRCA1 coding region requires 22000 ASOs. Each column contains an ASO differing only at the nucleotide Each column contains an ASO differing only at the nucleotide position under analysis. position under analysis. BRCA1 DNA from any allele can hybridize with one of the four BRCA1 DNA from any allele can hybridize with one of the four ASOs in a column. in a column
IL.Deletion-insertionpolymorphisms(InDels orDIPs)Short insertions or deletions of DNA sequences that are 2-100bplong.Distributed at about one in every 1o kb of DNA.Mutation rate of less than 10-9 perlocus per gamete.Caused by mutagenic events that expand or contract the lengthofnonrepetitiveDNA.Small deletions and duplications arise by unequal crossing-overSmallinsertions can also be caused bytransposableelements11-20
Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 11-20 II. Deletion II. Deletion-insertion polymorphisms ( insertion polymorphisms (InDels or DIPs) Short insertions or deletions of DNA sequences that are 2-100 bp long. Distributed at about one in every 10 kb of DNA. Mutation rate of less than 10-9 per locus per gamete. Caused by mutagenic events that expand or contract the length of nonrepetitive DNA. Small deletions and duplications arise by unequal crossing-over. Small insertions can also be caused by transposable elements